Nucleic Acid Detection: Methods and Protocols by Erin K. Hanson, Jack Ballantyne (auth.), Dmitry M.

By Erin K. Hanson, Jack Ballantyne (auth.), Dmitry M. Kolpashchikov, Yulia V. Gerasimova (eds.)

In Nucleic Acid Chemistry: equipment and Protocols, professional researches within the box element options and techniques for the detection of DNA and RNA. those options comprise the restoration of hint quantities of DNA for amplification and research, new qPCR chemistries, new software of isothermal amplification options, assays with visible or electrical indications for point-of-care diagnostics, development of fluorescent in situ hybridization, and new sign amplification thoughts. Written within the hugely winning Methods in Molecular Biology series layout, chapters comprise introductions to their respective issues, lists of the required fabrics and reagents, step by step, comfortably reproducible laboratory protocols, and key pointers on troubleshooting and warding off identified pitfalls.

Authoritative and functional, Nucleic Acid Chemistry: equipment and Protocols seeks to assist scientists within the extra examine of detection for DNA and RNA.

Show description

Read Online or Download Nucleic Acid Detection: Methods and Protocols PDF

Best nonfiction_9 books

Grundlagen elektrischer Maschinen, Neunte Auflage

Content material: bankruptcy 1 Transformator (pages 43–201): bankruptcy 2 Allgemeine Betrachtungen uber rotierende elektrische Maschinen (pages 203–281): bankruptcy three Gleichstrommaschine (pages 283–357): bankruptcy four Allgemeine Betrachtungen uber Maschinen mit Drehfeldern als Luftspaltfeld (pages 359–392): bankruptcy five Dreiphasen?

Hadronic Transport Coefficients from Effective Field Theories

This dissertation makes a speciality of the calculation of shipping coefficients within the subject created in a relativistic heavy-ion collision after chemical freeze-out. This subject might be good approximated utilizing a pion gasoline out of equilibrium. We describe the theoretical framework had to receive the shear and bulk viscosities, the thermal and electric conductivities and the flavour diffusion coefficients of a meson fuel at low temperatures.

34th Hemophilia Symposium: Hamburg 2003

This booklet comprises the contributions to the thirty fourth Hemophilia Symposium, Hamburg 2003. the most subject matters are HIV an infection and epidemiology, administration of bleedings in hemophiliacs with inhibitors, orthopedic difficulties and remedy in hemophiliacs, treatment with protein C and pediatric hemostaseology. the quantity is rounded off through a number of unfastened papers and posters on hemophilia, hemophiliacs with inhibitors, thrombophilia and molecular diagnostics.

Additional info for Nucleic Acid Detection: Methods and Protocols

Sample text

25 μM Locked nucleic acid (LNA)-based probes (Exiqon, Vedbaek, Denmark) with the trademark of miRCURY LNA™ detection probe (see Note 2). Probe sequence for miR-146a is AACCCATGGAATTCAGTTCTCA and it is labeled with digoxigenin (DIG) at the 5′ end. The human miR-146a target sequence is UGAGAACUGAAUUCCAUGGGUU. Negative control probe sequence is GTGTAACACGTCTATACGCCCA and it is 5′-DIG labeled as well. 7. Sakura Finetek Tissue-Tek Slide Staining Set. 8. Plastic coverslip. 9. Moisture chamber. 22 Zonggao Shi et al.

The probe-binding domain of the partzymes can be complementary to any one of a series of well-characterized universal probes. Since there is no need to synthesize and optimize new target-specific probes for each new target, MNAzyme qPCR provides a flexible alternative which allows target-specific interrogation with a generic readout. A series of universal probes have been designed that perform with high reliability, yielding consistent and reproducible results for any target, making the development of multiplex qPCR assays faster, cheaper, and simpler.

In general, only highly specialized assays, such as those targeting SNPs or variant genotypes, require optimization. The ease of design provided by the universal MNAzyme probes extends to multiplex applications. The probes have been designed and tested to ensure that there is no cross-reactivity with partzymes designed to bind to the other probes. The probes have also been tested to ensure that they provide consistent reliable performance when mixed together in any multiplex reaction. New targets can be added to a reaction without the need to test for cross-reactivity between each assay or the requirement to develop a new genespecific fluorescently labeled probe.

Download PDF sample

Rated 4.13 of 5 – based on 32 votes